Transcribe to mRNA

input a String and Transcribe the given DNA strand into corresponding mRNA - a type of RNA, that will be formed from it after transcription. DNA has the bases A, T, G and C, while RNA converts to U, A, C and G respectively.

Notes
Transcription is the process of making complementary strand.
A, T, G and C in DNA converts to U, A, C and G respectively, when in mRNA.
ATTAGCGCGATATACGCGTAC
Total : 0 Discussion
Login